5e3l

From Proteopedia
Revision as of 15:27, 6 March 2024 by OCA (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)

Structural highlights

5e3l is a 4 chain structure with sequence from Escherichia coli K-12 and Synthetic construct. Full crystallographic information is available from OCA. For a guided tour on the structure components use FirstGlance.
Method:X-ray diffraction, Resolution 2.66Å
Resources:FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT

Function

FIS_ECOLI Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.[1] [2]

See Also

References

  1. Ross W, Thompson JF, Newlands JT, Gourse RL. E.coli Fis protein activates ribosomal RNA transcription in vitro and in vivo. EMBO J. 1990 Nov;9(11):3733-42. PMID:2209559
  2. Wold S, Crooke E, Skarstad K. The Escherichia coli Fis protein prevents initiation of DNA replication from oriC in vitro. Nucleic Acids Res. 1996 Sep 15;24(18):3527-32. PMID:8836178

5e3l, resolution 2.66Å

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)Proteopedia Page Contributors and Editors (what is this?)

OCA