5e3m

From Proteopedia
Revision as of 16:12, 10 February 2016 by OCA (talk | contribs)
Jump to navigation Jump to search

Unreleased structure

The entry 5e3m is ON HOLD

Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)

Proteopedia Page Contributors and Editors (what is this?)Proteopedia Page Contributors and Editors (what is this?)

OCA