5e3n

From Proteopedia
Revision as of 05:23, 1 December 2015 by OCA (talk | contribs)
Jump to navigation Jump to search

Unreleased structure

The entry 5e3n is ON HOLD until Paper Publication

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)Proteopedia Page Contributors and Editors (what is this?)

OCA