5e3o

From Proteopedia
Revision as of 05:56, 16 October 2015 by OCA (talk | contribs) (New page: '''Unreleased structure''' The entry 5e3o is ON HOLD Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTC...)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Unreleased structure

The entry 5e3o is ON HOLD

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)Proteopedia Page Contributors and Editors (what is this?)

OCA