5e3m
Unreleased structure
The entry 5e3m is ON HOLD until Paper Publication
Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
Unreleased structure
The entry 5e3m is ON HOLD until Paper Publication
Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.
Description: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)