5e3o: Difference between revisions
No edit summary |
No edit summary |
||
Line 1: | Line 1: | ||
==Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)== | |||
<StructureSection load='5e3o' size='340' side='right' caption='[[5e3o]], [[Resolution|resolution]] 2.78Å' scene=''> | |||
== Structural highlights == | |||
<table><tr><td colspan='2'>[[5e3o]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3O OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5E3O FirstGlance]. <br> | |||
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3n|5e3n]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr> | |||
[[ | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5e3o FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3o OCA], [http://pdbe.org/5e3o PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3o RCSB], [http://www.ebi.ac.uk/pdbsum/5e3o PDBsum]</span></td></tr> | ||
[[ | </table> | ||
[[ | == Function == | ||
[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref> | |||
== References == | |||
<references/> | |||
__TOC__ | |||
</StructureSection> | |||
[[Category: Cascio, D]] | [[Category: Cascio, D]] | ||
[[Category: Hancock, S P]] | |||
[[Category: Johnson, R C]] | |||
[[Category: Dna bending]] | |||
[[Category: Dna binding protein-dna complex]] | |||
[[Category: Hth domain]] | |||
[[Category: Indirect recognition]] | |||
[[Category: Protein-dna complex]] |