5dtd: Difference between revisions

From Proteopedia
Jump to navigation Jump to search
← Older editNewer edit →
No edit summary
No edit summary
Line 1: Line 1:
'''Unreleased structure'''


The entry 5dtd is ON HOLD  until Paper Publication
==Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)==
 
<StructureSection load='5dtd' size='340' side='right' caption='[[5dtd]], [[Resolution|resolution]] 2.64&Aring;' scene=''>
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
== Structural highlights ==
 
<table><tr><td colspan='2'>[[5dtd]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DTD OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5DTD FirstGlance]. <br>
Description: Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5dtd FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5dtd OCA], [http://pdbe.org/5dtd PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5dtd RCSB], [http://www.ebi.ac.uk/pdbsum/5dtd PDBsum]</span></td></tr>
[[Category: Unreleased Structures]]
</table>
[[Category: Hancock, S.P]]
== Function ==
[[Category: Johnson, R.C]]
[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref> 
== References ==
<references/>
__TOC__
</StructureSection>
[[Category: Cascio, D]]
[[Category: Cascio, D]]
[[Category: Hancock, S P]]
[[Category: Johnson, R C]]
[[Category: Dna bending]]
[[Category: Dna binding protein-dna complex]]
[[Category: Hth domain]]
[[Category: Indirect recognition]]
[[Category: Protein-dna complex]]

Revision as of 06:55, 10 March 2016

Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)

Structural highlights

5dtd is a 4 chain structure. Full crystallographic information is available from OCA. For a guided tour on the structure components use FirstGlance.
Resources:FirstGlance, OCA, PDBe, RCSB, PDBsum

Function

[FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.[1] [2]

References

  1. ↑ Ross W, Thompson JF, Newlands JT, Gourse RL. E.coli Fis protein activates ribosomal RNA transcription in vitro and in vivo. EMBO J. 1990 Nov;9(11):3733-42. PMID:2209559
  2. ↑ Wold S, Crooke E, Skarstad K. The Escherichia coli Fis protein prevents initiation of DNA replication from oriC in vitro. Nucleic Acids Res. 1996 Sep 15;24(18):3527-32. PMID:8836178

5dtd, resolution 2.64Å

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)Proteopedia Page Contributors and Editors (what is this?)

OCA
Retrieved from "https://proteopedia.openfox.io/wiki/index.php?title=5dtd&oldid=2582254"