5e3o: Difference between revisions

Revision as of 05:56, 16 October 2015

Unreleased structure

The entry 5e3o is ON HOLD

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)

Revision as of 05:56, 16 October 2015 view source OCA (talk \| contribs) Bots, Bureaucrats, Administrators 3,175,590 edits New page: '''Unreleased structure''' The entry 5e3o is ON HOLD Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTC...	Revision as of 05:56, 16 October 2015 view source OCA (talk \| contribs) Bots, Bureaucrats, Administrators 3,175,590 edits m Protected "5e3o" [edit=sysop:move=sysop] Newer edit →
(No difference)