5e3o: Difference between revisions
No edit summary |
No edit summary |
||
Line 1: | Line 1: | ||
==Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)== | ==Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)== | ||
<StructureSection load='5e3o' size='340' side='right' caption='[[5e3o]], [[Resolution|resolution]] 2.78Å' scene=''> | <StructureSection load='5e3o' size='340' side='right'caption='[[5e3o]], [[Resolution|resolution]] 2.78Å' scene=''> | ||
== Structural highlights == | == Structural highlights == | ||
<table><tr><td colspan='2'>[[5e3o]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3O OCA]. For a <b>guided tour on the structure components</b> use [http:// | <table><tr><td colspan='2'>[[5e3o]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Ecoli Ecoli]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3O OCA]. For a <b>guided tour on the structure components</b> use [http://proteopedia.org/fgij/fg.htm?mol=5E3O FirstGlance]. <br> | ||
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3n|5e3n]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr> | </td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3n|5e3n]], [[5e3m|5e3m]], [[5ds9|5ds9]], [[5dtd|5dtd]]</td></tr> | ||
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http:// | <tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">fis, b3261, JW3229 ([http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 ECOLI])</td></tr> | ||
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://proteopedia.org/fgij/fg.htm?mol=5e3o FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3o OCA], [http://pdbe.org/5e3o PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3o RCSB], [http://www.ebi.ac.uk/pdbsum/5e3o PDBsum], [http://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3o ProSAT]</span></td></tr> | |||
</table> | </table> | ||
== Function == | == Function == | ||
Line 18: | Line 19: | ||
</div> | </div> | ||
<div class="pdbe-citations 5e3o" style="background-color:#fffaf0;"></div> | <div class="pdbe-citations 5e3o" style="background-color:#fffaf0;"></div> | ||
==See Also== | |||
*[[FIS protein|FIS protein]] | |||
== References == | == References == | ||
<references/> | <references/> | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
[[Category: Ecoli]] | |||
[[Category: Large Structures]] | |||
[[Category: Cascio, D]] | [[Category: Cascio, D]] | ||
[[Category: Hancock, S P]] | [[Category: Hancock, S P]] |