5e3m: Difference between revisions

← Older edit Newer edit →

Proteopedia Page Contributors and Editors (what is this?)Proteopedia Page Contributors and Editors (what is this?)

OCA

@@ Line 1: / Line 1: @@
-'''Unreleased structure'''
-The entry 5e3m is ON HOLD  until Paper Publication
+==Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)==
+<StructureSection load='5e3m' size='340' side='right' caption='[[5e3m]], [[Resolution|resolution]] 2.89&Aring;' scene=''>
-Authors: Stella, S., Hancock, S.P., Cascio, D., Johnson, R.C.
+== Structural highlights ==
+<table><tr><td colspan='2'>[[5e3m]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3M OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5E3M FirstGlance]. <br>
-Description: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
+</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[5e3l|5e3l]], [[5e3n|5e3n]], [[5e3o|5e3o]]</td></tr>
-[[Category: Unreleased Structures]]
+<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5e3m FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3m OCA], [http://pdbe.org/5e3m PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5e3m RCSB], [http://www.ebi.ac.uk/pdbsum/5e3m PDBsum]</span></td></tr>
-[[Category: Hancock, S.P]]
+</table>
+== Function ==
+[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
+== References ==
+<references/>
+__TOC__
+</StructureSection>
+[[Category: Cascio, D]]
+[[Category: Hancock, S P]]
+[[Category: Johnson, R C]]
 [[Category: Stella, S]]
-[[Category: Johnson, R.C]]
+[[Category: Dna bending]]
-[[Category: Cascio, D]]
+[[Category: Dna binding protein-dna complex]]
+[[Category: Hth domain]]
+[[Category: Indirect recognition]]
+[[Category: Minor groove compression]]
+[[Category: Protein-dna complex]]