5e3o: Difference between revisions

From Proteopedia
Jump to navigation Jump to search
m Protected "5e3o" [edit=sysop:move=sysop]
No edit summary
Line 1: Line 1:
'''Unreleased structure'''
'''Unreleased structure'''


The entry 5e3o is ON HOLD  
The entry 5e3o is ON HOLD until Paper Publication


Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Revision as of 05:23, 1 December 2015

Unreleased structure

The entry 5e3o is ON HOLD until Paper Publication

Authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Description: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)

Proteopedia Page Contributors and Editors (what is this?)Proteopedia Page Contributors and Editors (what is this?)

OCA