5e3o: Difference between revisions

From Proteopedia
Jump to navigation Jump to search
← Older edit
No edit summary
No edit summary
 
Line 9: Line 9:
== Function ==
== Function ==
[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>  
[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>  
<div style="background-color:#fffaf0;">
== Publication Abstract from PubMed ==
The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequences in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. The affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.
DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.,Hancock SP, Stella S, Cascio D, Johnson RC PLoS One. 2016 Mar 9;11(3):e0150189. doi: 10.1371/journal.pone.0150189., eCollection 2016. PMID:26959646<ref>PMID:26959646</ref>
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
</div>
<div class="pdbe-citations 5e3o" style="background-color:#fffaf0;"></div>


==See Also==
==See Also==

Latest revision as of 15:27, 6 March 2024

Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)

Structural highlights

5e3o is a 4 chain structure with sequence from Escherichia coli K-12 and Synthetic construct. Full crystallographic information is available from OCA. For a guided tour on the structure components use FirstGlance.
Method:X-ray diffraction, Resolution 2.78Å
Resources:FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT

Function

FIS_ECOLI Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.[1] [2]

See Also

References

  1. ↑ Ross W, Thompson JF, Newlands JT, Gourse RL. E.coli Fis protein activates ribosomal RNA transcription in vitro and in vivo. EMBO J. 1990 Nov;9(11):3733-42. PMID:2209559
  2. ↑ Wold S, Crooke E, Skarstad K. The Escherichia coli Fis protein prevents initiation of DNA replication from oriC in vitro. Nucleic Acids Res. 1996 Sep 15;24(18):3527-32. PMID:8836178

5e3o, resolution 2.78Å

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)Proteopedia Page Contributors and Editors (what is this?)

OCA
Retrieved from "https://proteopedia.openfox.io/wiki/index.php?title=5e3o&oldid=4080544"