5e3o: Difference between revisions

From Proteopedia
Jump to navigation Jump to search
m Protected "5e3o" [edit=sysop:move=sysop]
No edit summary
 
(5 intermediate revisions by the same user not shown)
Line 1: Line 1:
'''Unreleased structure'''


The entry 5e3o is ON HOLD
==Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)==
<StructureSection load='5e3o' size='340' side='right'caption='[[5e3o]], [[Resolution|resolution]] 2.78&Aring;' scene=''>
== Structural highlights ==
<table><tr><td colspan='2'>[[5e3o]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12] and [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3O OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5E3O FirstGlance]. <br>
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.78&#8491;</td></tr>
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5e3o FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3o OCA], [https://pdbe.org/5e3o PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5e3o RCSB], [https://www.ebi.ac.uk/pdbsum/5e3o PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3o ProSAT]</span></td></tr>
</table>
== Function ==
[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>


Authors: Hancock, S.P., Cascio, D., Johnson, R.C.
==See Also==
 
*[[FIS protein|FIS protein]]
Description: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
== References ==
[[Category: Unreleased Structures]]
<references/>
[[Category: Hancock, S.P]]
__TOC__
[[Category: Johnson, R.C]]
</StructureSection>
[[Category: Cascio, D]]
[[Category: Escherichia coli K-12]]
[[Category: Large Structures]]
[[Category: Synthetic construct]]
[[Category: Cascio D]]
[[Category: Hancock SP]]
[[Category: Johnson RC]]

Latest revision as of 15:27, 6 March 2024

Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)

Structural highlights

5e3o is a 4 chain structure with sequence from Escherichia coli K-12 and Synthetic construct. Full crystallographic information is available from OCA. For a guided tour on the structure components use FirstGlance.
Method:X-ray diffraction, Resolution 2.78Å
Resources:FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT

Function

FIS_ECOLI Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.[1] [2]

See Also

References

  1. Ross W, Thompson JF, Newlands JT, Gourse RL. E.coli Fis protein activates ribosomal RNA transcription in vitro and in vivo. EMBO J. 1990 Nov;9(11):3733-42. PMID:2209559
  2. Wold S, Crooke E, Skarstad K. The Escherichia coli Fis protein prevents initiation of DNA replication from oriC in vitro. Nucleic Acids Res. 1996 Sep 15;24(18):3527-32. PMID:8836178

5e3o, resolution 2.78Å

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)Proteopedia Page Contributors and Editors (what is this?)

OCA