5e3o: Difference between revisions
New page: '''Unreleased structure''' The entry 5e3o is ON HOLD Authors: Hancock, S.P., Cascio, D., Johnson, R.C. Description: Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTC... |
No edit summary |
||
(6 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
==Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)== | |||
<StructureSection load='5e3o' size='340' side='right'caption='[[5e3o]], [[Resolution|resolution]] 2.78Å' scene=''> | |||
== Structural highlights == | |||
<table><tr><td colspan='2'>[[5e3o]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12] and [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3O OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5E3O FirstGlance]. <br> | |||
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.78Å</td></tr> | |||
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5e3o FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3o OCA], [https://pdbe.org/5e3o PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5e3o RCSB], [https://www.ebi.ac.uk/pdbsum/5e3o PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3o ProSAT]</span></td></tr> | |||
</table> | |||
== Function == | |||
[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref> | |||
==See Also== | |||
*[[FIS protein|FIS protein]] | |||
== References == | |||
[[Category: | <references/> | ||
[[Category: | __TOC__ | ||
[[Category: | </StructureSection> | ||
[[Category: | [[Category: Escherichia coli K-12]] | ||
[[Category: Large Structures]] | |||
[[Category: Synthetic construct]] | |||
[[Category: Cascio D]] | |||
[[Category: Hancock SP]] | |||
[[Category: Johnson RC]] |