1r7z: Difference between revisions
m Protected "1r7z" [edit=sysop:move=sysop] |
No edit summary |
||
(6 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
==NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE== | |||
<StructureSection load='1r7z' size='340' side='right'caption='[[1r7z]]' scene=''> | |||
== Structural highlights == | |||
<table><tr><td colspan='2'>[[1r7z]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=1R7Z OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=1R7Z FirstGlance]. <br> | |||
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">Solution NMR</td></tr> | |||
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=1r7z FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=1r7z OCA], [https://pdbe.org/1r7z PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=1r7z RCSB], [https://www.ebi.ac.uk/pdbsum/1r7z PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=1r7z ProSAT]</span></td></tr> | |||
</table> | |||
<div style="background-color:#fffaf0;"> | |||
== Publication Abstract from PubMed == | |||
The 5'-untranslated region of positive-strand RNA viruses harbors many cis-acting RNA structural elements that are important for various viral processes such as replication, translation, and packaging of new virions. Among these is loop B RNA of the stem-loop IV domain within the internal ribosomal entry site (IRES) of enteroviruses, including Poliovirus type 1 (PV1). Studies on PV1 have shown that specific recognition of loop B by the first KH (hnRNP K homology) domain of cellular poly(rC)-binding protein 2 (PCBP2) is essential for efficient translation of the viral mRNA. Here we report the NMR solution structures of two representative sequence variants of enteroviral loop B RNA. The two RNA variants differ at only one position (C vs U) within a six-nucleotide asymmetric internal loop sequence that is the binding site for the PCBP2 KH1 domain. Surprisingly, the two RNAs are drastically different in the overall shape and local dynamics of the bulge region. The RNA with the 5'-AUCCCU bulge sequence adopts an overall L shape. Its bulge nucleotides, especially the last four, are highly flexible and not very well defined by NMR. The RNA with the 5'-AUUCCU bulge sequence adopts an overall U shape, and its bulge sequence exhibits only limited flexibility. A detailed analysis of the two RNA structures and their dynamic properties, as well as available sequence data and known KH domain-RNA complex structures, not only provides insights into how loop B RNA might be recognized by the PCBP2 KH1 domain but also suggests a possible correlation between structural flexibility and pre-existing structural features for protein recognition. | |||
NMR structures of loop B RNAs from the stem-loop IV domain of the enterovirus internal ribosome entry site: a single C to U substitution drastically changes the shape and flexibility of RNA.,Du Z, Ulyanov NB, Yu J, Andino R, James TL Biochemistry. 2004 May 18;43(19):5757-71. PMID:15134450<ref>PMID:15134450</ref> | |||
From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | |||
</div> | |||
<div class="pdbe-citations 1r7z" style="background-color:#fffaf0;"></div> | |||
== References == | |||
<references/> | |||
= | __TOC__ | ||
</StructureSection> | |||
[[Category: Large Structures]] | |||
[[Category: Du Z]] | |||
[[Category: | [[Category: James TL]] | ||
[[Category: | [[Category: Ulyanov NB]] | ||
[[Category: | [[Category: Yu J]] | ||
[[Category: | |||
[[Category: | |||