Proteopedia

1qwb

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Structural highlights

1qwb is a 1 chain structure. Full experimental information is available from OCA. For a guided tour on the structure components use FirstGlance.
Method:Solution NMR
Resources:FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT
Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)Proteopedia Page Contributors and Editors (what is this?)

OCA
Retrieved from "https://proteopedia.openfox.io/wiki/index.php?title=1qwb&oldid=4130250"